ROUGE

Gene/Protein Characteristic Table for mKIAA1986

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK050946
Description :
Clone Name :	mph02350 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2935 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 630 bp

Genome contig ID gi65511124r_16300046
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CTCTCACACCTTTTCTAATAAACGGAGCTGGGGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCAGTGCCTCTGTTTCCTGCTGGGCGGGTGGGAGGGGGAGAGCGTGAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1986 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1986	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2305
Length: 767 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL23155	1.2e-204	100.0	cDNA sequence B...	Mus musculus
Q8BKR5	1.5e-187	100.0	Leucine-rich re...	Mus musculus
EDM08187	3.4e-179	96.1	similar to F28C...	Rattus norvegicus
XP_541567	6.6e-149	82.8	similar to F28C...	Canis lupus fam...
A7Z026	1.5e-138	83.6	Leucine-rich re...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220314	0.00029	28.0	mFLJ00348

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 310 323 PR00019 Leucine-rich repeat

IPR001611 393 406 PR00019 Leucine-rich repeat

HMMPfam IPR001611 309 333 PF00560 Leucine-rich repeat

IPR001611 338 362 PF00560 Leucine-rich repeat

IPR001611 395 423 PF00560 Leucine-rich repeat

HMMSmart IPR003590 279 306 SM00368 Leucine-rich repeat

IPR003590 307 335 SM00368 Leucine-rich repeat

IPR003590 336 363 SM00368 Leucine-rich repeat

IPR003590 365 392 SM00368 Leucine-rich repeat

IPR003590 393 420 SM00368 Leucine-rich repeat

IPR003590 421 448 SM00368 Leucine-rich repeat

IPR003590 449 476 SM00368 Leucine-rich repeat

ProfileScan IPR007091 374 457 PS50503 Leucine-rich repeat

IPR000694 654 727 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	310	323	PR00019	Leucine-rich repeat
IPR001611	393	406	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	309	333	PF00560	Leucine-rich repeat
IPR001611	338	362	PF00560	Leucine-rich repeat
IPR001611	395	423	PF00560	Leucine-rich repeat
HMMSmart	IPR003590	279	306	SM00368	Leucine-rich repeat
IPR003590	307	335	SM00368	Leucine-rich repeat
IPR003590	336	363	SM00368	Leucine-rich repeat
IPR003590	365	392	SM00368	Leucine-rich repeat
IPR003590	393	420	SM00368	Leucine-rich repeat
IPR003590	421	448	SM00368	Leucine-rich repeat
IPR003590	449	476	SM00368	Leucine-rich repeat
ProfileScan	IPR007091	374	457	PS50503	Leucine-rich repeat
IPR000694	654	727	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	630 bp
Genome contig ID	gi65511124r_16300046
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTCTCACACCTTTTCTAATAAACGGAGCTGGGGTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAGTGCCTCTGTTTCCTGCTGGGCGGGTGGGAGGGGGAGAGCGTGAGT

Gene/Protein Characteristic Table for mKIAA1986

Features of the cloned DNA sequence

Features of the protein sequence