KIAA1986

Gene/Protein Characteristic Table for KIAA1986

Order Kazusa clone(s) from :

Product ID	ORK05741
Accession No	AB075866
Description	protein phosphatase 1, regulatory subunit 37
Clone name	pg00636
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5949 bp) Predicted protein sequence (334 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1986 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5949 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1834 bp
Genome contig ID	gi42406306f_50237157
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGAGTGAGATCCTGTCTCAAAAAAAAAAAAAAAG
Flanking genome sequence (106020 - 106069)	----+--------+--------+--------+--------+----* TTACTAAACGAGCATTTCTGGGCCACCCATCCCCTTGTTTCCCGTGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	50336516	50343175	3	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 334 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75864	1.2e-54	99.6	Leucine-rich re...	Homo sapiens
A7Z026	5.7e-40	76.7	Leucine-rich re...	Bos taurus
XP_541567	2.5e-36	73.4	similar to F28C...	Canis lupus fam...
AAH24868	1.1e-22	71.5	Lrrc68 protein ...	Mus musculus
Q8BKR5	1.9e-22	71.5	Leucine-rich re...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTGGGGCTTAGTTCTCATCTC
Primer_r	AGATGGTCAGGCTCAAGGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 19

Experimental conditions

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp