ROUGE

Gene/Protein Characteristic Table for mKIAA1966

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173312
Description :	Inferred: RNA splicing-related protein (Fragment).
Clone Name :	mic07029 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 4706 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3713 bp

Genome contig ID gi65498774f_85979094
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GTTTTGTATGAAATAAATTGATAAAGATTGACACT
Flanking genome sequence
(119420 - 119469)
----+----*----+----*----+----*----+----*----+----*
AACTTGCTGTATTTCCTTGTCTGATTGCATAAGTATGACAATATATTCTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1966 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1966	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..942, 3375..3956
Length: 507 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_808348	1.3e-155	98.3	YTH domain cont...	Mus musculus
Q96MU7	8.5e-154	97.8	YTH domain-cont...	Homo sapiens
XP_517262	8.5e-154	97.8	splicing factor...	Pan troglodytes
EDL89830	9.5e-154	96.9	splicing factor...	Rattus norvegicus
Q9QY02	2.8e-153	96.7	YTH domain-cont...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 297 307 PR00929 HMG-I and HMG-Y

IPR000637 462 473 PR00929 HMG-I and HMG-Y

IPR000637 476 486 PR00929 HMG-I and HMG-Y

HMMPfam IPR007275 179 275 PF04146 YT521-B-like protein

ProfileScan NULL 1 40 PS50313 NULL

NULL 288 361 PS50323 NULL

IPR000694 381 423 PS50099 Proline-rich region

NULL 427 507 PS50323 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	297	307	PR00929	HMG-I and HMG-Y
IPR000637	462	473	PR00929	HMG-I and HMG-Y
IPR000637	476	486	PR00929	HMG-I and HMG-Y
HMMPfam	IPR007275	179	275	PF04146	YT521-B-like protein
ProfileScan	NULL	1	40	PS50313	NULL
NULL	288	361	PS50323	NULL
IPR000694	381	423	PS50099	Proline-rich region
NULL	427	507	PS50323	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3713 bp
Genome contig ID	gi65498774f_85979094
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTTTGTATGAAATAAATTGATAAAGATTGACACT
Flanking genome sequence (119420 - 119469)	----+--------+--------+--------+--------+----* AACTTGCTGTATTTCCTTGTCTGATTGCATAAGTATGACAATATATTCTC

Gene/Protein Characteristic Table for mKIAA1966

Features of the cloned DNA sequence

Features of the protein sequence