ROUGE

Gene/Protein Characteristic Table for mKIAA1933

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173304
Description :	Protein arginine N-methyltransferase.
Clone Name :	mpj03948 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2272 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 43 bp

Genome contig ID gi65515060f_105406882
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
TGAGAAATAAAATGGCCAGCAGGCTGCAGACTCTG
Flanking genome sequence
(140660 - 140709)
----+----*----+----*----+----*----+----*----+----*
AATGGCTTGTGGCTCAATGGGGAAGCAAGGCCGAGGAACTTACCTCCTTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1933 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1933	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 106..2229
Length: 707 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q922X9	100.0	Protein arginin...	Mus musculus
AAH57177	99.9	Protein arginin...	Mus musculus
AAH85121	94.5	Protein arginin...	Rattus norvegicus
Q99MI9	91.6	Protein arginin...	Cricetulus long...
AAK20885	91.9	arginine N-meth...	Cricetulus long...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000051 76 134 PS50193 SAM (and some other nucleotide) binding motif

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000051	76	134	PS50193	SAM (and some other nucleotide) binding motif

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	43 bp
Genome contig ID	gi65515060f_105406882
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TGAGAAATAAAATGGCCAGCAGGCTGCAGACTCTG
Flanking genome sequence (140660 - 140709)	----+--------+--------+--------+--------+----* AATGGCTTGTGGCTCAATGGGGAAGCAAGGCCGAGGAACTTACCTCCTTG

Gene/Protein Characteristic Table for mKIAA1933

Features of the cloned DNA sequence

Features of the protein sequence