Gene/Protein Characteristic Table for KIAA1933
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06493
Accession No AB067520
Description protein arginine methyltransferase 7
Clone name fk00541
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3567 bp)
Predicted protein sequence (500 aa)
Source Human fetal brain
Rouge ID mKIAA1933 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3567 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 1364 bp
Genome contig ID gi51511732f_66815615
PolyA signal sequence
(AATACA,-12)
+----*----+----*----+----*----+----
CATGAAGATACAATACAGAAAAAAATACAGAAATT
Flanking genome sequence
(134354 - 134403)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGTTTTTATAACAGTATTTCTAAATCTCAGCAAGTTAAAAAGCAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 66915387 66949967 11 99.5 Internal No-hit
Features of the protein sequence
Description

Length: 500 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW83228 1.1e-216 100.0 protein arginin...
Homo sapiens
XP_863705 2.6e-196 86.5 similar to Prot...
Canis lupus fam...
EAW83232 1.3e-102 64.7 protein arginin...
Homo sapiens
BAB14215 1.3e-102 85.6 unnamed protein...
Homo sapiens
EAW83226 1.3e-102 85.7 protein arginin...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGCTTCTCTCACACACTAACC
Primer_r ACACCGGAACTCTGCTCATAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp