ROUGE

Gene/Protein Characteristic Table for mKIAA1928

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173302
Description :	regucalcin gene promotor region related protein. RGPR-p117.
Clone Name :	mic28011 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 4574 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1075 bp

Genome contig ID gi65488608f_157312384
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TGTTGATAGCGATTAAATCCAGATAATTTTATAGC
Flanking genome sequence
(161609 - 161658)
----+----*----+----*----+----*----+----*----+----*
AAATGCTTGTCTCTGGCTGGTTTCTGCAGAGAGAGAAAATACATTGATGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1928 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1928	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 305..3499
Length: 1064 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q91XT4	99.7	Protein transpo...	Mus musculus
AAH59194	99.6	SEC16 homolog B...	Mus musculus
BAB61034	99.2	RGPR-p117 [Mus ...	Mus musculus
Q75N33	89.8	Protein transpo...	Rattus norvegicus
BAB43905	88.6	RGPR-p117 [Ratt...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122242	1.3e-48	37.7	mKIAA0310

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 913 993 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	913	993	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1075 bp
Genome contig ID	gi65488608f_157312384
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TGTTGATAGCGATTAAATCCAGATAATTTTATAGC
Flanking genome sequence (161609 - 161658)	----+--------+--------+--------+--------+----* AAATGCTTGTCTCTGGCTGGTTTCTGCAGAGAGAGAAAATACATTGATGG

Gene/Protein Characteristic Table for mKIAA1928

Features of the cloned DNA sequence

Features of the protein sequence