ROUGE |
Gene/Protein Characteristic Table for mKIAA1927 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093303 |
---|---|
Sperm-specific antigen 2. | |
mbg00348 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4966 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1217 bp Genome contig ID gi66880554f_79233300 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
AACCCCATTAAAACAATAAAGAATTTATTTTGCCTFlanking genome sequence
(137414 - 137463) ----+----*----+----*----+----*----+----*----+----*
AAAATGTTAAATTTATTTTTTGAGCTGTAACATGAAGAATTTGGATTACA
KIAA Alignment based on: KIAA1927 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 3..3749
Length: 1248 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |