ROUGE

Gene/Protein Characteristic Table for mKIAA1927

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093303
Description :	Sperm-specific antigen 2.
Clone Name :	mbg00348 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1217 bp

Genome contig ID gi66880554f_79233300
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AACCCCATTAAAACAATAAAGAATTTATTTTGCCT
Flanking genome sequence
(137414 - 137463)
----+----*----+----*----+----*----+----*----+----*
AAAATGTTAAATTTATTTTTTGAGCTGTAACATGAAGAATTTGGATTACA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1927 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA1927	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 3..3749
Length: 1248 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q922B9	100.0	Sperm-specific ...	Mus musculus
AAI22520	100.0	Ssfa2 protein [...	Mus musculus
BAC87833	99.9	KRAP [Mus muscu...	Mus musculus
CAM14505	99.8	sperm specific ...	Mus musculus
CAM14507	99.8	sperm specific ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1217 bp
Genome contig ID	gi66880554f_79233300
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACCCCATTAAAACAATAAAGAATTTATTTTGCCT
Flanking genome sequence (137414 - 137463)	----+--------+--------+--------+--------+----* AAAATGTTAAATTTATTTTTTGAGCTGTAACATGAAGAATTTGGATTACA

Gene/Protein Characteristic Table for mKIAA1927

Features of the cloned DNA sequence

Features of the protein sequence