Order Kazusa clone(s) from : ![]() |
Product ID | ORK01185 |
---|---|
Accession No | AB067514 |
Description | sperm specific antigen 2, transcript variant 1 |
Clone name | hj03131 |
Vector information | |
cDNA sequence | DNA sequence (5167 bp) Predicted protein sequence (1325 aa) |
Flexi ORF Clone | FXC01185 |
Source | Human adult brain |
Rouge ID |
mKIAA1927
by Kazusa Mouse cDNA Project
|
Note | We replaced ah01387, former representative clones for KIAA1927 with hj03131. (2003/8/28) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1188 bp |
---|---|
Genome contig ID | gi89161199f_182364915 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (138794 - 138843) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 182464840 | 182503707 | 18 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 1059 | 1325 | PD120214 | NULL |
![]() |
Primer_f | GCAAGTCAGCATTCCGATAGC |
---|---|
Primer_r | TAACTGTTGTCTCACTGTCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |