| ROUGE |
Gene/Protein Characteristic Table for mKIAA1924 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129465 |
|---|---|
| ras homolog gene family, member T2. mitochondrial Rho 2. |
|
| mpf00636 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5946 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 297 bp Genome contig ID gi65550231r_23550933 PolyA signal sequence
(AATAAA,-28)
TTAAGGAAATAAACACTGGCATTTATTATAGCGATFlanking genome sequence
(100000 - 99951)
ACATTGTTTTATTGTCCCATAAATTGTGTCTTTGCATCACTTCTGGCCTG
KIAA Alignment based on: KIAA1924 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 301..5649
Length: 1782 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR001680 | 602 | 616 | PR00320 | WD-40 repeat |
| IPR001680 | 685 | 699 | PR00320 | WD-40 repeat | |
| IPR001680 | 912 | 926 | PR00320 | WD-40 repeat | |
| HMMPfam | IPR001680 | 414 | 451 | PF00400 | WD-40 repeat |
| IPR001680 | 466 | 502 | PF00400 | WD-40 repeat | |
| IPR001680 | 580 | 615 | PF00400 | WD-40 repeat | |
| IPR001680 | 619 | 656 | PF00400 | WD-40 repeat | |
| IPR001680 | 661 | 698 | PF00400 | WD-40 repeat | |
| IPR001680 | 703 | 740 | PF00400 | WD-40 repeat | |
| IPR001680 | 745 | 782 | PF00400 | WD-40 repeat | |
| IPR001680 | 845 | 883 | PF00400 | WD-40 repeat | |
| IPR001680 | 888 | 925 | PF00400 | WD-40 repeat | |
| IPR001680 | 932 | 967 | PF00400 | WD-40 repeat | |
| IPR001680 | 1181 | 1218 | PF00400 | WD-40 repeat | |
| IPR001680 | 1229 | 1268 | PF00400 | WD-40 repeat | |
| IPR001680 | 1324 | 1359 | PF00400 | WD-40 repeat | |
| IPR001680 | 1364 | 1399 | PF00400 | WD-40 repeat | |
| IPR001680 | 1460 | 1497 | PF00400 | WD-40 repeat | |
| IPR001680 | 1502 | 1545 | PF00400 | WD-40 repeat | |
| IPR001680 | 1550 | 1587 | PF00400 | WD-40 repeat | |
| IPR001680 | 1742 | 1778 | PF00400 | WD-40 repeat | |
| HMMSmart | IPR001680 | 368 | 409 | SM00320 | WD-40 repeat |
| IPR001680 | 412 | 455 | SM00320 | WD-40 repeat | |
| IPR001680 | 462 | 502 | SM00320 | WD-40 repeat | |
| IPR001680 | 577 | 615 | SM00320 | WD-40 repeat | |
| IPR001680 | 618 | 656 | SM00320 | WD-40 repeat | |
| IPR001680 | 658 | 698 | SM00320 | WD-40 repeat | |
| IPR001680 | 701 | 740 | SM00320 | WD-40 repeat | |
| IPR001680 | 743 | 782 | SM00320 | WD-40 repeat | |
| IPR001680 | 840 | 883 | SM00320 | WD-40 repeat | |
| IPR001680 | 886 | 925 | SM00320 | WD-40 repeat | |
| IPR001680 | 930 | 967 | SM00320 | WD-40 repeat | |
| IPR001680 | 1180 | 1224 | SM00320 | WD-40 repeat | |
| IPR001680 | 1227 | 1268 | SM00320 | WD-40 repeat | |
| IPR001680 | 1274 | 1309 | SM00320 | WD-40 repeat | |
| IPR001680 | 1312 | 1359 | SM00320 | WD-40 repeat | |
| IPR001680 | 1362 | 1399 | SM00320 | WD-40 repeat | |
| IPR001680 | 1458 | 1497 | SM00320 | WD-40 repeat | |
| IPR001680 | 1500 | 1545 | SM00320 | WD-40 repeat | |
| IPR001680 | 1549 | 1587 | SM00320 | WD-40 repeat | |
| IPR001680 | 1590 | 1639 | SM00320 | WD-40 repeat | |
| IPR001680 | 1740 | 1778 | SM00320 | WD-40 repeat | |
| ProfileScan | IPR001680 | 624 | 791 | PS50294 | WD-40 repeat |
| IPR001680 | 666 | 707 | PS50082 | WD-40 repeat | |
| IPR001680 | 850 | 976 | PS50294 | WD-40 repeat | |
| IPR001680 | 1186 | 1596 | PS50294 | WD-40 repeat | |
| IPR001680 | 1465 | 1506 | PS50082 | WD-40 repeat | |
| IPR001680 | 1555 | 1585 | PS50082 | WD-40 repeat | |
| IPR001680 | 1747 | 1782 | PS50082 | WD-40 repeat | |
| IPR001680 | 1747 | 1782 | PS50294 | WD-40 repeat | |
| ScanRegExp | IPR001680 | 685 | 699 | PS00678 | WD-40 repeat |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
