Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07360 |
---|---|
Accession No | AB067511 |
Description | WD repeat domain 90 |
Clone name | hh01339 |
Vector information | |
cDNA sequence | DNA sequence (5499 bp) Predicted protein sequence (613 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1924
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3575 bp |
---|---|
Genome contig ID | gi51511732f_539312 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (111766 - 111815) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 639312 | 651076 | 26 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 502 | GAAVVYPCHAVIVVLLVDTGEQR | 524 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TACCTGTATGTGCTCTTTCGG |
---|---|
Primer_r | CGTGGCCGTAGACTTAAACTC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |