ROUGE

Gene/Protein Characteristic Table for mKIAA1915

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173300
Description :
Clone Name :	mib23081 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 7164 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4926 bp

Genome contig ID gi65493515r_93817113
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
TTAAAAATAAAACAGGTAGTTTTTGATGTCTTTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTATTAGCAATGTTATTGAATTACAGAAGAAAGGCACTTAGTTACCG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1915 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1915	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2238
Length: 745 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q69Z66	100.0	Protein MYSM1; ...	Mus musculus
XP_216460	89.4	similar to myb-...	Rattus norvegicus
XP_513441	79.3	hypothetical pr...	Pan troglodytes
Q5VVJ2	79.3	Protein MYSM1; ...	Homo sapiens
XP_593335	78.8	similar to myb-...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001005 41 86 PF00249 Myb

IPR007526 289 378 PF04433 SWIRM

IPR000555 489 599 PF01398 Mov34/MPN/PAD-1

HMMSmart NULL 40 88 SM00395 NULL

IPR000555 495 617 SM00232 Mov34/MPN/PAD-1

ProfileScan IPR001005 36 86 PS50090 Myb

IPR000555 492 578 PS50249 Mov34/MPN/PAD-1

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001005	41	86	PF00249	Myb
IPR007526	289	378	PF04433	SWIRM
IPR000555	489	599	PF01398	Mov34/MPN/PAD-1
HMMSmart	NULL	40	88	SM00395	NULL
IPR000555	495	617	SM00232	Mov34/MPN/PAD-1
ProfileScan	IPR001005	36	86	PS50090	Myb
IPR000555	492	578	PS50249	Mov34/MPN/PAD-1

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4926 bp
Genome contig ID	gi65493515r_93817113
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- TTAAAAATAAAACAGGTAGTTTTTGATGTCTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTATTAGCAATGTTATTGAATTACAGAAGAAAGGCACTTAGTTACCG

Gene/Protein Characteristic Table for mKIAA1915

Features of the cloned DNA sequence

Features of the protein sequence