Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06089 |
---|---|
Accession No | AB067502 |
Description | Myb-like, SWIRM and MPN domains 1 |
Clone name | hf00664 |
Vector information | |
cDNA sequence | DNA sequence (7801 bp) Predicted protein sequence (726 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1915
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5265 bp |
---|---|
Genome contig ID | gi89161185r_58793000 |
PolyA signal sequence (AATAAA,-9) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 58893000 | 58927922 | 16 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR014778 | 16 | 61 | PF00249 | Myb |
IPR007526 | 270 | 359 | PF04433 | SWIRM | |
IPR000555 | 470 | 580 | PF01398 | Mov34/MPN/PAD-1 | |
HMMSmart | IPR001005 | 15 | 63 | SM00717 | SANT |
IPR000555 | 474 | 606 | SM00232 | Mov34/MPN/PAD-1 | |
ProfileScan | IPR001005 | 11 | 61 | PS50090 | SANT |
IPR007526 | 270 | 368 | PS50934 | SWIRM |
RT-PCR-ELISA |
Primer_f | GGGAATAATAGTTGATGCCAG |
---|---|
Primer_r | TTCCTCATGGCTTTCCTCTAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |