ROUGE |
Gene/Protein Characteristic Table for mKIAA1847 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173276 |
---|---|
Lck-interacting transmembrane adaptor protein. | |
mfj06075 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4892 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3199 bp Genome contig ID gi66880554f_180982410 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
CCAGTCCTTGAGGCCTAATTAAACCTCTGTTCAATFlanking genome sequence
(118176 - 118225) ----+----*----+----*----+----*----+----*----+----*
AAGGTTGGCTCTTGGTTGCTTTTTATCTATATCTATCTATCTATTTTGAA
KIAA Alignment based on: KIAA1847 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 125..1690
Length: 522 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |