ROUGE

Gene/Protein Characteristic Table for mKIAA1835

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129452
Description :	Ran GTPase-activating protein 1.
Clone Name :	mph00586 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2877 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 935 bp

Genome contig ID gi65543215r_81654969
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GGAGCTTCACAAATAAACGTCATCTGTGTAGTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAGGCCCGGAAGCTTCTTTCATCAAAAGCGGGGACGACCCAGCTTAGGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1835 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1835	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1942
Length: 646 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL04561	3.3e-189	97.6	RAN GTPase acti...	Mus musculus
AAB60517	1.7e-183	100.0	RNA1 homolog.	Mus musculus
BAC40559	2.4e-183	99.8	unnamed protein...	Mus musculus
AAH66213	4.3e-183	99.8	Rangap1 protein...	Mus musculus
AAH52862	4.8e-183	99.8	Rangap1 protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093267	0.00065	27.8	mKIAA0835
AK220314	0.001	29.3	mFLJ00348

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 171 184 PR00019 Leucine-rich repeat

IPR001611 377 390 PR00019 Leucine-rich repeat

HMMPfam IPR001611 170 193 PF00560 Leucine-rich repeat

IPR009109 463 645 PF07834 Ran-GTPase activating protein 1

HMMSmart IPR003590 105 132 SM00368 Leucine-rich repeat

IPR003590 168 195 SM00368 Leucine-rich repeat

IPR003590 198 225 SM00368 Leucine-rich repeat

IPR003590 264 291 SM00368 Leucine-rich repeat

IPR003590 292 319 SM00368 Leucine-rich repeat

IPR003590 320 347 SM00368 Leucine-rich repeat

IPR003590 349 376 SM00368 Leucine-rich repeat

IPR003590 377 404 SM00368 Leucine-rich repeat

ProfileScan IPR007091 177 272 PS50503 Leucine-rich repeat

IPR007091 273 357 PS50503 Leucine-rich repeat

NULL 418 465 PS50313 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	171	184	PR00019	Leucine-rich repeat
IPR001611	377	390	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	170	193	PF00560	Leucine-rich repeat
IPR009109	463	645	PF07834	Ran-GTPase activating protein 1
HMMSmart	IPR003590	105	132	SM00368	Leucine-rich repeat
IPR003590	168	195	SM00368	Leucine-rich repeat
IPR003590	198	225	SM00368	Leucine-rich repeat
IPR003590	264	291	SM00368	Leucine-rich repeat
IPR003590	292	319	SM00368	Leucine-rich repeat
IPR003590	320	347	SM00368	Leucine-rich repeat
IPR003590	349	376	SM00368	Leucine-rich repeat
IPR003590	377	404	SM00368	Leucine-rich repeat
ProfileScan	IPR007091	177	272	PS50503	Leucine-rich repeat
IPR007091	273	357	PS50503	Leucine-rich repeat
NULL	418	465	PS50313	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	935 bp
Genome contig ID	gi65543215r_81654969
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GGAGCTTCACAAATAAACGTCATCTGTGTAGTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGGCCCGGAAGCTTCTTTCATCAAAAGCGGGGACGACCCAGCTTAGGA

Gene/Protein Characteristic Table for mKIAA1835

Features of the cloned DNA sequence

Features of the protein sequence