ROUGE |
Gene/Protein Characteristic Table for mKIAA1835 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129452 |
---|---|
Ran GTPase-activating protein 1. | |
mph00586 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2877 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 935 bp Genome contig ID gi65543215r_81654969 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
GGAGCTTCACAAATAAACGTCATCTGTGTAGTTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGAGGCCCGGAAGCTTCTTTCATCAAAAGCGGGGACGACCCAGCTTAGGA
KIAA Alignment based on: KIAA1835 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1942
Length: 646 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 171 | 184 | PR00019 | Leucine-rich repeat |
IPR001611 | 377 | 390 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 170 | 193 | PF00560 | Leucine-rich repeat |
IPR009109 | 463 | 645 | PF07834 | Ran-GTPase activating protein 1 | |
HMMSmart | IPR003590 | 105 | 132 | SM00368 | Leucine-rich repeat |
IPR003590 | 168 | 195 | SM00368 | Leucine-rich repeat | |
IPR003590 | 198 | 225 | SM00368 | Leucine-rich repeat | |
IPR003590 | 264 | 291 | SM00368 | Leucine-rich repeat | |
IPR003590 | 292 | 319 | SM00368 | Leucine-rich repeat | |
IPR003590 | 320 | 347 | SM00368 | Leucine-rich repeat | |
IPR003590 | 349 | 376 | SM00368 | Leucine-rich repeat | |
IPR003590 | 377 | 404 | SM00368 | Leucine-rich repeat | |
ProfileScan | IPR007091 | 177 | 272 | PS50503 | Leucine-rich repeat |
IPR007091 | 273 | 357 | PS50503 | Leucine-rich repeat | |
NULL | 418 | 465 | PS50313 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |