| ROUGE |
Gene/Protein Characteristic Table for mKIAA1791 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173265 |
|---|---|
| Cell division cycle 2-like 5. | |
| mpm08259 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5385 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 583 bp Genome contig ID gi65535943r_17081178 PolyA signal sequence
(AATAAA,-28)
TCAGAAAAATAAAACACAACCTTTCTCTTGAAAACFlanking genome sequence
(99997 - 99948)
AACAGTTTTATATAAAAAATGGTCAACATTATTTTTGTTTTGTTTTTTTC
KIAA Alignment based on: KIAA1791 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 444..4802
Length: 1452 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000719 | 706 | 920 | PD000001 | Protein kinase |
| FPrintScan | IPR000104 | 460 | 474 | PR00308 | Antifreeze protein |
| IPR000104 | 474 | 485 | PR00308 | Antifreeze protein | |
| IPR000104 | 485 | 494 | PR00308 | Antifreeze protein | |
| HMMPfam | IPR000719 | 706 | 999 | PF00069 | Protein kinase |
| HMMSmart | IPR002290 | 706 | 999 | SM00220 | Serine/threonine protein kinase |
| IPR001245 | 706 | 999 | SM00219 | Tyrosine protein kinase | |
| ProfileScan | IPR000694 | 35 | 58 | PS50099 | Proline-rich region |
| NULL | 63 | 77 | PS50310 | NULL | |
| IPR001472 | 91 | 108 | PS50079 | Bipartite nuclear localization signal | |
| NULL | 181 | 450 | PS50324 | NULL | |
| NULL | 190 | 436 | PS50323 | NULL | |
| NULL | 452 | 494 | PS50310 | NULL | |
| IPR000719 | 706 | 999 | PS50011 | Protein kinase | |
| IPR000694 | 1187 | 1209 | PS50099 | Proline-rich region | |
| ScanRegExp | IPR000719 | 712 | 735 | PS00107 | Protein kinase |
| IPR008271 | 834 | 846 | PS00108 | Serine/threonine protein kinase |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
