ROUGE |
Gene/Protein Characteristic Table for mKIAA0936 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173068 |
---|---|
Serine/threonine kinase ICK. | |
mic27001 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5866 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4353 bp Genome contig ID gi65519420f_78219574 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGGAAACTTCTGCTCCAAATAAAGTTAAATTCAAGFlanking genome sequence
(121580 - 121629) ----+----*----+----*----+----*----+----*----+----*
AAACATTGACTAGAATTTTTTGTCTTTTGTACCGTTTCAGTAGATGGTAC
KIAA Alignment based on: KIAA0936 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1513
Length: 503 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 1 | 158 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 1 | 158 | PF00069 | Protein kinase |
HMMSmart | IPR002290 | 1 | 158 | SM00220 | Serine/threonine protein kinase |
ProfileScan | IPR000719 | 1 | 158 | PS50011 | Protein kinase |
NULL | 387 | 429 | PS50324 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |