ROUGE

Gene/Protein Characteristic Table for mKIAA1786

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220418
Description :
Clone Name :	mbp11245 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1222 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2 bp

Genome contig ID gi65498774f_124689399
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCTCTCACCATGGTAAGGAAACAGGGCTCATGAAG
Flanking genome sequence
(176287 - 176336)
----+----*----+----*----+----*----+----*----+----*
ATGAGCCATGAAGGAACTTCTTTTGAGTATTTTTTTGTTTTGTTTTGTTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1786 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1786	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1220
Length: 405 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_984094	2.6e-176	100.0	similar to tran...	Mus musculus
XP_920802	5.5e-176	99.7	similar to tran...	Mus musculus
EDL19552	5e-161	99.7	mCG142549 [Mus ...	Mus musculus
EAW98476	2.7e-147	81.5	transmembrane p...	Homo sapiens
Q14DG7	4.8e-147	81.5	Transmembrane p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173207	2.3e-10	28.4	mKIAA1583

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2 bp
Genome contig ID	gi65498774f_124689399
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTCTCACCATGGTAAGGAAACAGGGCTCATGAAG
Flanking genome sequence (176287 - 176336)	----+--------+--------+--------+--------+----* ATGAGCCATGAAGGAACTTCTTTTGAGTATTTTTTTGTTTTGTTTTGTTT

Gene/Protein Characteristic Table for mKIAA1786

Features of the cloned DNA sequence

Features of the protein sequence