ROUGE

Gene/Protein Characteristic Table for mKIAA1783

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173262
Description :	LOC217328 protein (Fragment).
Clone Name :	mej00370 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2825 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 214 bp

Genome contig ID gi65527427f_115601529
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AGAGGATGCTTAATAAATAACCTTGGTTTTCCTGG
Flanking genome sequence
(107012 - 107061)
----+----*----+----*----+----*----+----*----+----*
TTTCTGGTGTCACTCCTCTTGGGTCTAATGGGTATGGGGACCAGGGCCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1783 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1783	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2611
Length: 869 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_986778	0	99.9	similar to like...	Mus musculus
CAM21226	0	99.1	myosin XVB [Mus...	Mus musculus
XP_001492235	1.1e-152	70.6	similar to hCG1...	Equus caballus
EAW89288	1.6e-151	70.3	hCG1987119, iso...	Homo sapiens
Q96JP2	1.9e-151	70.3	Putative myosin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001452 779 835 PF00018 SH3

IPR011511 780 835 PF07653 Variant SH3

HMMSmart IPR001452 779 836 SM00326 SH3

ProfileScan IPR000694 69 561 PS50099 Proline-rich region

NULL 208 261 PS50322 NULL

IPR001452 776 837 PS50002 SH3

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001452	779	835	PF00018	SH3
IPR011511	780	835	PF07653	Variant SH3
HMMSmart	IPR001452	779	836	SM00326	SH3
ProfileScan	IPR000694	69	561	PS50099	Proline-rich region
NULL	208	261	PS50322	NULL
IPR001452	776	837	PS50002	SH3

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	214 bp
Genome contig ID	gi65527427f_115601529
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGAGGATGCTTAATAAATAACCTTGGTTTTCCTGG
Flanking genome sequence (107012 - 107061)	----+--------+--------+--------+--------+----* TTTCTGGTGTCACTCCTCTTGGGTCTAATGGGTATGGGGACCAGGGCCTG

Gene/Protein Characteristic Table for mKIAA1783

Features of the cloned DNA sequence

Features of the protein sequence