ROUGE |
Gene/Protein Characteristic Table for mKIAA1761 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122553 |
---|---|
mbg04392 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4992 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3333 bp Genome contig ID gi65492966r_107308362 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
GTATTCTGTTTACATTAAAAGAAAGCAAAACTGTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CGTGTTGCCTTGTGTGTAGATGCAGGCTCTGGGGACTGGGGATGCAGCAC
KIAA Alignment based on: KIAA1761 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 1..1656, 3679..4305
Length: 760 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR012486 | 48 | 361 | PF07923 | N1221-like |
ProfileScan | IPR000694 | 1 | 34 | PS50099 | Proline-rich region |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |