Order Kazusa clone(s) from : ![]() |
Product ID | ORK02052 |
---|---|
Accession No | AB051548 |
Description | striatin interacting protein 1, transcript variant 1 |
Clone name | ha03234 |
Vector information | |
cDNA sequence | DNA sequence (3237 bp) Predicted protein sequence (837 aa) |
HaloTag ORF Clone |
FHC02052
![]() |
Flexi ORF Clone | FXC02052 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA1761
by Kazusa Mouse cDNA Project
|
Note | We replaced fh26843, former representative clones for KIAA1761 with ha03234. (2001/2/07) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 721 bp |
---|---|
Genome contig ID | gi89161185f_110278781 |
PolyA signal sequence (ATTAAA,-13) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (119999 - 120048) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 110378781 | 110398778 | 21 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 512 | GLLPSLPQYMIALLKILLAAAP | 533 | SECONDARY | 22 | 2 | 571 | KEVIVKAISAVLLLLLKHFKLNH | 593 | PRIMARY | 23 | 3 | 597 | FEYMAQHLVFANCIPLILKFFNQ | 619 | SECONDARY | 23 |
---|
Primer_f | TCCGCCGTGCATCTGAATTTC |
---|---|
Primer_r | GAGCCTCCGCAATTACTTCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |