ROUGE

Gene/Protein Characteristic Table for mKIAA1758

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173254
Description :	Cortactin-binding protein 2 homolog (Fragment).
Clone Name :	mic23055 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 5646 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1555 bp

Genome contig ID gi65504368r_18315963
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AATAACACACTGATAATAAAACTAATATTTTCTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTGTGTCTTATAAATAAATGGTGAAATTATTGATCCAATTCACAGTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1758 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1758	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..4085, 4094..4705
Length: 1565 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAR16298	99.7	cortactin-bindi...	Mus musculus
AAI41408	99.7	Cttnbp2 protein...	Mus musculus
AAR16316	94.8	cortactin-bindi...	Rattus norvegicus
A0M8T5	84.5	Cortactin-bindi...	Felis catus
Q07E28	84.4	Cortactin-bindi...	Neofelis nebulosa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129359	7.5e-14	38.8	mKIAA1433

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 765 777 PR01415 Ankyrin

IPR002110 810 822 PR01415 Ankyrin

HMMPfam IPR002110 731 763 PF00023 Ankyrin

IPR002110 764 796 PF00023 Ankyrin

IPR002110 797 829 PF00023 Ankyrin

IPR002110 830 867 PF00023 Ankyrin

IPR002110 899 932 PF00023 Ankyrin

HMMSmart IPR002110 697 727 SM00248 Ankyrin

IPR002110 731 760 SM00248 Ankyrin

IPR002110 764 793 SM00248 Ankyrin

IPR002110 797 826 SM00248 Ankyrin

IPR002110 830 859 SM00248 Ankyrin

IPR002110 899 929 SM00248 Ankyrin

ProfileScan IPR002110 697 851 PS50297 Ankyrin

IPR002110 731 763 PS50088 Ankyrin

IPR002110 764 796 PS50088 Ankyrin

IPR002110 797 829 PS50088 Ankyrin

IPR002110 830 851 PS50088 Ankyrin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	765	777	PR01415	Ankyrin
IPR002110	810	822	PR01415	Ankyrin
HMMPfam	IPR002110	731	763	PF00023	Ankyrin
IPR002110	764	796	PF00023	Ankyrin
IPR002110	797	829	PF00023	Ankyrin
IPR002110	830	867	PF00023	Ankyrin
IPR002110	899	932	PF00023	Ankyrin
HMMSmart	IPR002110	697	727	SM00248	Ankyrin
IPR002110	731	760	SM00248	Ankyrin
IPR002110	764	793	SM00248	Ankyrin
IPR002110	797	826	SM00248	Ankyrin
IPR002110	830	859	SM00248	Ankyrin
IPR002110	899	929	SM00248	Ankyrin
ProfileScan	IPR002110	697	851	PS50297	Ankyrin
IPR002110	731	763	PS50088	Ankyrin
IPR002110	764	796	PS50088	Ankyrin
IPR002110	797	829	PS50088	Ankyrin
IPR002110	830	851	PS50088	Ankyrin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1555 bp
Genome contig ID	gi65504368r_18315963
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AATAACACACTGATAATAAAACTAATATTTTCTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGTGTCTTATAAATAAATGGTGAAATTATTGATCCAATTCACAGTTA

Gene/Protein Characteristic Table for mKIAA1758

Features of the cloned DNA sequence

Features of the protein sequence