ROUGE

Gene/Protein Characteristic Table for mKIAA1721

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129430
Description :	Exportin 4.
Clone Name :	mpm03365 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4723 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1272 bp

Genome contig ID gi65540054r_52016192
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGCTAGTCTGGGTTACAATGTATGATCTATCTTT
Flanking genome sequence
(99906 - 99857)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAAGAAAAATTCTCTTTAGATCCTCTGGCTTTTCTAATCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1721 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1721	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3451
Length: 1149 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ESJ0	100.0	Exportin-4; Sho...	Mus musculus
EDM14355	99.0	exportin 4 (pre...	Rattus norvegicus
XP_001085699	98.6	exportin 4 [Mac...	Macaca mulatta
Q9C0E2	98.5	Exportin-4; Sho...	Homo sapiens
XP_001489040	97.4	exportin 4 [Equ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122361	2.2e-12	20.5	mKIAA0745

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 998 1034 PF02985 HEAT

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	998	1034	PF02985	HEAT

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1272 bp
Genome contig ID	gi65540054r_52016192
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGCTAGTCTGGGTTACAATGTATGATCTATCTTT
Flanking genome sequence (99906 - 99857)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAAGAAAAATTCTCTTTAGATCCTCTGGCTTTTCTAATCA

Gene/Protein Characteristic Table for mKIAA1721

Features of the cloned DNA sequence

Features of the protein sequence