ROUGE |
Gene/Protein Characteristic Table for mKIAA1696 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129424 |
---|---|
BRAF35/HDAC2 complex. | |
mpm12224 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3969 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1411 bp Genome contig ID gi66880554f_91790007 PolyA signal sequence
(CATAAA,-27) +----*----+----*----+----*----+----
TTCACTACCATAAAACCAAAAAACGAAAAAAAAAGFlanking genome sequence
(275590 - 275639) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAGATAAAAAAGGAAATAGAGATTTAACTAACCCAGTGCCCAGAA
KIAA Alignment based on: KIAA1696 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1371..2474, 2558..3481
Length: 675 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000637 | 421 | 433 | PF02178 | HMG-I and HMG-Y |
IPR001965 | 486 | 531 | PF00628 | Zinc finger | |
HMMSmart | IPR001965 | 486 | 529 | SM00249 | Zinc finger |
ProfileScan | NULL | 15 | 132 | PS50322 | NULL |
IPR000694 | 234 | 282 | PS50099 | Proline-rich region | |
IPR001965 | 484 | 531 | PS50016 | Zinc finger | |
ScanRegExp | IPR001965 | 487 | 528 | PS01359 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |