ROUGE

Gene/Protein Characteristic Table for mKIAA1696

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129424
Description :	BRAF35/HDAC2 complex.
Clone Name :	mpm12224 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3969 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1411 bp

Genome contig ID gi66880554f_91790007
PolyA signal sequence
(CATAAA,-27)
+----*----+----*----+----*----+----
TTCACTACCATAAAACCAAAAAACGAAAAAAAAAG
Flanking genome sequence
(275590 - 275639)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGATAAAAAAGGAAATAGAGATTTAACTAACCCAGTGCCCAGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1696 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1696	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1371..2474, 2558..3481
Length: 675 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6ZPK0	3.6e-182	100.0	PHD finger prot...	Mus musculus
XP_342468	7.6e-88	91.9	similar to BRAF...	Rattus norvegicus
BAC29735	2.6e-87	82.3	unnamed protein...	Mus musculus
CAM20613	3.3e-87	86.9	PHD finger prot...	Mus musculus
CAM20611	3.4e-87	94.5	PHD finger prot...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129293	0.00046	22.8	mKIAA1113

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000637 421 433 PF02178 HMG-I and HMG-Y

IPR001965 486 531 PF00628 Zinc finger

HMMSmart IPR001965 486 529 SM00249 Zinc finger

ProfileScan NULL 15 132 PS50322 NULL

IPR000694 234 282 PS50099 Proline-rich region

IPR001965 484 531 PS50016 Zinc finger

ScanRegExp IPR001965 487 528 PS01359 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000637	421	433	PF02178	HMG-I and HMG-Y
IPR001965	486	531	PF00628	Zinc finger
HMMSmart	IPR001965	486	529	SM00249	Zinc finger
ProfileScan	NULL	15	132	PS50322	NULL
IPR000694	234	282	PS50099	Proline-rich region
IPR001965	484	531	PS50016	Zinc finger
ScanRegExp	IPR001965	487	528	PS01359	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1411 bp
Genome contig ID	gi66880554f_91790007
PolyA signal sequence (CATAAA,-27)	+--------+--------+----*----+---- TTCACTACCATAAAACCAAAAAACGAAAAAAAAAG
Flanking genome sequence (275590 - 275639)	----+--------+--------+--------+--------+----* AAAAAAAGATAAAAAAGGAAATAGAGATTTAACTAACCCAGTGCCCAGAA

Gene/Protein Characteristic Table for mKIAA1696

Features of the cloned DNA sequence

Features of the protein sequence