ROUGE

Gene/Protein Characteristic Table for mKIAA1113

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129293
Description :	tripartite motif protein 33.
Clone Name :	mpm06042 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4871 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1654 bp

Genome contig ID gi65492966f_102607428
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
ATCAAATAAAGTGCTCTAAAGAAATTATTACACAG
Flanking genome sequence
(175524 - 175573)
----+----*----+----*----+----*----+----*----+----*
ATTCCTTTGGGTTGTTTTTTCTTAAGGGATGTGGGTAAAGAGGAGGAGTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1113 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1113	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3217
Length: 1071 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073299	99.8	tripartite moti...	Mus musculus
XP_001064397	98.2	similar to trip...	Rattus norvegicus
Q99PP7	98.4	E3 ubiquitin-pr...	Mus musculus
NP_444400	98.3	tripartite moti...	Mus musculus
AAG53510	94.7	tripartite moti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK172929	2.6e-10	45.2	mKIAA0298

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000315 247 264 PR01406 Zinc finger

IPR000315 265 279 PR01406 Zinc finger

IPR001487 951 967 PR00503 Bromodomain

IPR001487 970 988 PR00503 Bromodomain

IPR001487 988 1007 PR00503 Bromodomain

HMMPfam IPR000315 176 221 PF00643 Zinc finger

IPR000315 235 274 PF00643 Zinc finger

IPR001965 850 895 PF00628 Zinc finger

IPR001487 923 1012 PF00439 Bromodomain

HMMSmart IPR001965 86 147 SM00249 Zinc finger

IPR001841 87 146 SM00184 Zinc finger

IPR000315 174 221 SM00336 Zinc finger

IPR001841 179 241 SM00184 Zinc finger

IPR000315 233 274 SM00336 Zinc finger

IPR003649 281 407 SM00502 B-box

IPR001965 850 893 SM00249 Zinc finger

IPR001841 851 892 SM00184 Zinc finger

IPR001487 920 1026 SM00297 Bromodomain

ProfileScan NULL 1 68 PS50310 NULL

IPR000694 43 80 PS50099 Proline-rich region

IPR001841 87 147 PS50089 Zinc finger

IPR000315 174 221 PS50119 Zinc finger

IPR000315 233 274 PS50119 Zinc finger

NULL 470 582 PS50322 NULL

NULL 654 731 PS50324 NULL

IPR001965 848 895 PS50016 Zinc finger

IPR001487 935 1007 PS50014 Bromodomain

ScanRegExp IPR001841 107 116 PS00518 Zinc finger

IPR001965 851 892 PS01359 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	247	264	PR01406	Zinc finger
IPR000315	265	279	PR01406	Zinc finger
IPR001487	951	967	PR00503	Bromodomain
IPR001487	970	988	PR00503	Bromodomain
IPR001487	988	1007	PR00503	Bromodomain
HMMPfam	IPR000315	176	221	PF00643	Zinc finger
IPR000315	235	274	PF00643	Zinc finger
IPR001965	850	895	PF00628	Zinc finger
IPR001487	923	1012	PF00439	Bromodomain
HMMSmart	IPR001965	86	147	SM00249	Zinc finger
IPR001841	87	146	SM00184	Zinc finger
IPR000315	174	221	SM00336	Zinc finger
IPR001841	179	241	SM00184	Zinc finger
IPR000315	233	274	SM00336	Zinc finger
IPR003649	281	407	SM00502	B-box
IPR001965	850	893	SM00249	Zinc finger
IPR001841	851	892	SM00184	Zinc finger
IPR001487	920	1026	SM00297	Bromodomain
ProfileScan	NULL	1	68	PS50310	NULL
IPR000694	43	80	PS50099	Proline-rich region
IPR001841	87	147	PS50089	Zinc finger
IPR000315	174	221	PS50119	Zinc finger
IPR000315	233	274	PS50119	Zinc finger
NULL	470	582	PS50322	NULL
NULL	654	731	PS50324	NULL
IPR001965	848	895	PS50016	Zinc finger
IPR001487	935	1007	PS50014	Bromodomain
ScanRegExp	IPR001841	107	116	PS00518	Zinc finger
IPR001965	851	892	PS01359	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1654 bp
Genome contig ID	gi65492966f_102607428
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- ATCAAATAAAGTGCTCTAAAGAAATTATTACACAG
Flanking genome sequence (175524 - 175573)	----+--------+--------+--------+--------+----* ATTCCTTTGGGTTGTTTTTTCTTAAGGGATGTGGGTAAAGAGGAGGAGTA

Gene/Protein Characteristic Table for mKIAA1113

Features of the cloned DNA sequence

Features of the protein sequence