ROUGE

Gene/Protein Characteristic Table for mKIAA1662

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129417
Description :	TRIO and F-actin binding protein (Fragment).
Clone Name :	mfk00026 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3978 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 663 bp

Genome contig ID gi65543215f_78934393
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
CCGTGAGTCACCCTAACTTAATAAAACCTTCCGGC
Flanking genome sequence
(122758 - 122807)
----+----*----+----*----+----*----+----*----+----*
AACTCTGGCTCTGTGGATGCTGGGCTTCCAGGGTAGGGAGTGGGAATCGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1662 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1662	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..442, 1906..3315
Length: 616 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_001019887	3.2e-200	99.4	TRIO and F-acti...	Mus musculus
XP_001065869	1.1e-194	96.9	similar to TRIO...	Rattus norvegicus
AAI69041	1.6e-193	96.9	Triobp protein ...	Rattus norvegicus
BAC35308	2.3e-189	99.3	unnamed protein...	Mus musculus
AAH42760	6.8e-189	99.1	Triobp protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093269	1.4e-20	44.5	mKIAA0864

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 39 138 PF00169 Pleckstrin-like

HMMSmart IPR001849 39 140 SM00233 Pleckstrin-like

ProfileScan IPR001849 38 138 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	39	138	PF00169	Pleckstrin-like
HMMSmart	IPR001849	39	140	SM00233	Pleckstrin-like
ProfileScan	IPR001849	38	138	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	663 bp
Genome contig ID	gi65543215f_78934393
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- CCGTGAGTCACCCTAACTTAATAAAACCTTCCGGC
Flanking genome sequence (122758 - 122807)	----+--------+--------+--------+--------+----* AACTCTGGCTCTGTGGATGCTGGGCTTCCAGGGTAGGGAGTGGGAATCGG

Gene/Protein Characteristic Table for mKIAA1662

Features of the cloned DNA sequence

Features of the protein sequence