ROUGE

Gene/Protein Characteristic Table for mKIAA1645

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173227
Description :	Guanine nucleotide-binding protein beta subunit-like protein 1.
Clone Name :	mfj18213 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3549 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2393 bp

Genome contig ID gi65546577f_17169939
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CCTAAAAGTTACCCCAATAAAGTCATTGGTTCACT
Flanking genome sequence
(167793 - 167842)
----+----*----+----*----+----*----+----*----+----*
ACGCTAGACTTGATTTGTCCAGGGGACTGTCATCAGTGCCTTATCTGGGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1645 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1645	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1156
Length: 384 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9EQ15	2.8e-133	100.0	Guanine nucleot...	Mus musculus
AAG44996	7.6e-133	99.7	WDVCF variant 1...	Mus musculus
BAE42345	8.8e-133	99.7	unnamed protein...	Mus musculus
XP_001057185	5.8e-124	92.0	similar to Guan...	Rattus norvegicus
BAB26980	1.6e-115	88.3	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001680 97 111 PR00320 WD-40 repeat

IPR001680 238 252 PR00320 WD-40 repeat

IPR001680 366 380 PR00320 WD-40 repeat

HMMPfam IPR001680 68 110 PF00400 WD-40 repeat

IPR001680 115 153 PF00400 WD-40 repeat

IPR001680 256 293 PF00400 WD-40 repeat

IPR001680 301 338 PF00400 WD-40 repeat

IPR001680 343 379 PF00400 WD-40 repeat

HMMSmart IPR001680 66 110 SM00320 WD-40 repeat

IPR001680 113 153 SM00320 WD-40 repeat

IPR001680 204 251 SM00320 WD-40 repeat

IPR001680 254 293 SM00320 WD-40 repeat

IPR001680 296 338 SM00320 WD-40 repeat

IPR001680 341 379 SM00320 WD-40 repeat

ProfileScan IPR001680 73 119 PS50082 WD-40 repeat

IPR001680 73 162 PS50294 WD-40 repeat

IPR001680 237 384 PS50294 WD-40 repeat

IPR001680 261 302 PS50082 WD-40 repeat

IPR001680 348 380 PS50082 WD-40 repeat

ScanRegExp IPR001680 238 252 PS00678 WD-40 repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001680	97	111	PR00320	WD-40 repeat
IPR001680	238	252	PR00320	WD-40 repeat
IPR001680	366	380	PR00320	WD-40 repeat
HMMPfam	IPR001680	68	110	PF00400	WD-40 repeat
IPR001680	115	153	PF00400	WD-40 repeat
IPR001680	256	293	PF00400	WD-40 repeat
IPR001680	301	338	PF00400	WD-40 repeat
IPR001680	343	379	PF00400	WD-40 repeat
HMMSmart	IPR001680	66	110	SM00320	WD-40 repeat
IPR001680	113	153	SM00320	WD-40 repeat
IPR001680	204	251	SM00320	WD-40 repeat
IPR001680	254	293	SM00320	WD-40 repeat
IPR001680	296	338	SM00320	WD-40 repeat
IPR001680	341	379	SM00320	WD-40 repeat
ProfileScan	IPR001680	73	119	PS50082	WD-40 repeat
IPR001680	73	162	PS50294	WD-40 repeat
IPR001680	237	384	PS50294	WD-40 repeat
IPR001680	261	302	PS50082	WD-40 repeat
IPR001680	348	380	PS50082	WD-40 repeat
ScanRegExp	IPR001680	238	252	PS00678	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2393 bp
Genome contig ID	gi65546577f_17169939
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCTAAAAGTTACCCCAATAAAGTCATTGGTTCACT
Flanking genome sequence (167793 - 167842)	----+--------+--------+--------+--------+----* ACGCTAGACTTGATTTGTCCAGGGGACTGTCATCAGTGCCTTATCTGGGG

Gene/Protein Characteristic Table for mKIAA1645

Features of the cloned DNA sequence

Features of the protein sequence