ROUGE

Gene/Protein Characteristic Table for mKIAA1555

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173200
Description :	human immunodeficiency virus type I enhancer binding protein 3. kappa B and Rss recognition component.
Clone Name :	mtj00168 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 3413 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 206 bp

Genome contig ID gi65493515f_119020774
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACCTGTGCCTTTTTCTAGACCTTTTGTTGCTTGAG
Flanking genome sequence
(136230 - 136279)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAAACAAAACAAATCACACACATCCATAAACAAAACAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1555 DNA sequence

KIAA	Alignment based on:
KIAA1555	DNA sequence

Features of the protein sequence	Description

Coding region: 1..3207
Length: 1068 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
A2A884	0	100.0	Transcription f...	Mus musculus
EDL80331	0	91.4	human immunodef...	Rattus norvegicus
AAR88090	0	97.7	zinc finger pro...	Mus musculus
AAA40039	1e-214	96.8	DNA-binding pro...	Mus musculus
XP_001916496	4.9e-210	74.9	similar to huma...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 440 462 PF00096 Zinc finger

IPR007087 468 492 PF00096 Zinc finger

HMMSmart IPR007087 440 462 SM00355 Zinc finger

IPR007087 468 492 SM00355 Zinc finger

ProfileScan IPR007087 440 467 PS50157 Zinc finger

IPR007087 468 497 PS50157 Zinc finger

NULL 498 561 PS50313 NULL

ScanRegExp IPR007087 442 462 PS00028 Zinc finger

IPR007087 470 492 PS00028 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	440	462	PF00096	Zinc finger
IPR007087	468	492	PF00096	Zinc finger
HMMSmart	IPR007087	440	462	SM00355	Zinc finger
IPR007087	468	492	SM00355	Zinc finger
ProfileScan	IPR007087	440	467	PS50157	Zinc finger
IPR007087	468	497	PS50157	Zinc finger
NULL	498	561	PS50313	NULL
ScanRegExp	IPR007087	442	462	PS00028	Zinc finger
IPR007087	470	492	PS00028	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	206 bp
Genome contig ID	gi65493515f_119020774
PolyA signal sequence (None)	+--------+--------+----*----+---- ACCTGTGCCTTTTTCTAGACCTTTTGTTGCTTGAG
Flanking genome sequence (136230 - 136279)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAACAAAACAAATCACACACATCCATAAACAAAACAAA

Gene/Protein Characteristic Table for mKIAA1555

Features of the cloned DNA sequence

Features of the protein sequence