ROUGE |
Gene/Protein Characteristic Table for mKIAA1555 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173200 |
---|---|
human immunodeficiency virus type I enhancer binding protein 3. kappa B and Rss recognition component. |
|
mtj00168 [Vector Info] | |
Source : | Mouse adult thymus |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3413 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 206 bp Genome contig ID gi65493515f_119020774 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACCTGTGCCTTTTTCTAGACCTTTTGTTGCTTGAGFlanking genome sequence
(136230 - 136279) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAAACAAAACAAATCACACACATCCATAAACAAAACAAA
KIAA Alignment based on: KIAA1555 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 1..3207
Length: 1068 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |