KIAA1555

Product ID	ORK01693
Accession No	AB046775
Description	human immunodeficiency virus type I enhancer binding protein 3, transcript variant 1
Clone name	fh17482s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8473 bp) Predicted protein sequence (2414 aa)
HaloTag ORF Clone	FHC01693
Flexi ORF Clone	FXC01693
Source	Human fetal brain
Rouge ID	mKIAA1555 by Kazusa Mouse cDNA Project
Note	We replaced fh17482s1 and fh17482, former representative clones for KIAA1555 with fh17482s2. (2008/8/27,2003/4/2)

Length: 8473 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	240 bp
Genome contig ID	gi89161185r_41648488
PolyA signal sequence (None)	+--------+--------+----*----+---- TCACATACATACATTTAAAAAAAAAACAACAACCC
Flanking genome sequence (99981 - 99932)	----+--------+--------+--------+--------+----* ACGAGGAGTCTGAGGCTGTGAATAGTTTATGGTTTTGGGGAAAGGCTGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	41748469	42156965	8	99.1	Perfect prediction

Length: 2414 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52564	100.0	HIVEP3 protein ...	Homo sapiens
EAX07173	99.9	human immunodef...	Homo sapiens
CAI14537	99.8	human immunodef...	Homo sapiens
Q5T1R4	99.8	Transcription f...	Homo sapiens
AAK01082	99.1	kappa B and V(D...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	201	223	PF00096	Zinc finger
	IPR007087	229	251	PF00096	Zinc finger
	IPR007087	652	675	PF00096	Zinc finger
	IPR007087	1763	1785	PF00096	Zinc finger
	IPR007087	1791	1815	PF00096	Zinc finger
HMMSmart	IPR015880	201	223	SM00355	Zinc finger
	IPR015880	229	251	SM00355	Zinc finger
	IPR015880	652	672	SM00355	Zinc finger
	IPR015880	1763	1785	SM00355	Zinc finger
	IPR015880	1791	1815	SM00355	Zinc finger
ProfileScan	IPR007087	201	228	PS50157	Zinc finger
	IPR007087	229	256	PS50157	Zinc finger
	IPR007087	652	679	PS50157	Zinc finger
	IPR007087	1763	1790	PS50157	Zinc finger
	IPR007087	1791	1820	PS50157	Zinc finger
ScanRegExp	IPR002034	75	91	PS00815	Alpha-isopropylmalate/homocitrate synthase
	IPR007087	203	223	PS00028	Zinc finger
	IPR007087	231	253	PS00028	Zinc finger
	IPR007087	1765	1785	PS00028	Zinc finger
	IPR007087	1793	1815	PS00028	Zinc finger

Primer_f	AAGGTACGGACTCAAAGAAGG
Primer_r	GTACAAACTTATGCACCAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	AAGGAACCTGAGAAGACTGAG
Primer_r	AGACATTGCTTTCCTGGCTCG
PCR product length	190 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles