ROUGE |
Gene/Protein Characteristic Table for mKIAA1545 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129388 |
---|---|
mbh00801 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4592 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 604 bp Genome contig ID gi65498774r_109313223 PolyA signal sequence
(ATTAAA,-25) +----*----+----*----+----*----+----
TATAAAACTTATTAAATTCTTAACCTGGACAGTCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATAACAAGTTTCTAGAAACCCCTCTGGTTATTTGTGTACGTGGTCACAAA
KIAA Alignment based on: KIAA1545 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..321, 2843..3988
Length: 488 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |