ROUGE

Gene/Protein Characteristic Table for mKIAA1539

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173197
Description :
Clone Name :	mie30018 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 1817 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1119 bp

Genome contig ID gi65493515r_42848433
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AAAAAAAAAAGAATAAATTCTTGTTGGGAAACTTG
Flanking genome sequence
(99906 - 99857)
----+----*----+----*----+----*----+----*----+----*
AACTAACCTCTACTTTTTTTTGTGTTCAAGAGGATGGAGATGTGGGGCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1539 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1539	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..698
Length: 231 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH71191	5.7e-97	100.0	RIKEN cDNA B230...	Mus musculus
BAE36360	5.7e-97	100.0	unnamed protein...	Mus musculus
BAE32803	2.4e-96	99.6	unnamed protein...	Mus musculus
BAE28988	2.8e-96	99.6	unnamed protein...	Mus musculus
XP_001090314	5.6e-95	97.0	similar to CG90...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173161	1.7e-44	53.2	mKIAA1370

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1119 bp
Genome contig ID	gi65493515r_42848433
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAAAAAAAAAGAATAAATTCTTGTTGGGAAACTTG
Flanking genome sequence (99906 - 99857)	----+--------+--------+--------+--------+----* AACTAACCTCTACTTTTTTTTGTGTTCAAGAGGATGGAGATGTGGGGCCT

Gene/Protein Characteristic Table for mKIAA1539

Features of the cloned DNA sequence

Features of the protein sequence