ROUGE

Gene/Protein Characteristic Table for mKIAA1370

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173161
Description :
Clone Name :	mbh00781 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4311 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1221 bp

Genome contig ID gi65519420f_74991831
PolyA signal sequence
(AATATA,-17)
+----*----+----*----+----*----+----
ATTAATATTTATATTGTAAATATATGCAAAAAACT
Flanking genome sequence
(179854 - 179903)
----+----*----+----*----+----*----+----*----+----*
AAAATGTGTATTTGGCTTTTATTCTTAAATGAGACATTTATGTGACTGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1370 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1370	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 127..3075, 3169..3519
Length: 1099 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL26297	99.9	cDNA sequence B...	Mus musculus
NP_001106754	99.8	hypothetical pr...	Mus musculus
EDL26298	99.8	cDNA sequence B...	Mus musculus
NP_705812	99.7	hypothetical pr...	Mus musculus
AAH31353	99.6	CDNA sequence B...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173197	7.8e-35	53.2	mKIAA1539

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1221 bp
Genome contig ID	gi65519420f_74991831
PolyA signal sequence (AATATA,-17)	+--------+--------+----*----+---- ATTAATATTTATATTGTAAATATATGCAAAAAACT
Flanking genome sequence (179854 - 179903)	----+--------+--------+--------+--------+----* AAAATGTGTATTTGGCTTTTATTCTTAAATGAGACATTTATGTGACTGTT

Gene/Protein Characteristic Table for mKIAA1370

Features of the cloned DNA sequence

Features of the protein sequence