ROUGE |
Gene/Protein Characteristic Table for mKIAA1518 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK045492 |
---|---|
ankyrin repeat domain 25. | |
mej02266 [Vector Info] | |
Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2641 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 876 bp Genome contig ID gi65519420r_21561252 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGACTACTTCTAGAAATACTTTCAGACCTACAAACFlanking genome sequence
(99997 - 99948) ----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAAGGCCATTCCGGAGTGACTCCCAGCATCACAGCCCAGA
KIAA Alignment based on: KIAA1518 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 2..1765
Length: 587 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002110 | 402 | 432 | PF00023 | Ankyrin |
IPR002110 | 474 | 506 | PF00023 | Ankyrin | |
IPR002110 | 507 | 540 | PF00023 | Ankyrin | |
IPR002110 | 541 | 570 | PF00023 | Ankyrin | |
HMMSmart | IPR002110 | 402 | 432 | SM00248 | Ankyrin |
IPR002110 | 436 | 469 | SM00248 | Ankyrin | |
IPR002110 | 474 | 503 | SM00248 | Ankyrin | |
IPR002110 | 507 | 537 | SM00248 | Ankyrin | |
IPR002110 | 541 | 569 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 396 | 564 | PS50297 | Ankyrin |
IPR002110 | 402 | 427 | PS50088 | Ankyrin | |
IPR002110 | 474 | 506 | PS50088 | Ankyrin |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |