Gene/Protein Characteristic Table for mKIAA1518

Length: 2641 bp

Restriction map

Length of 3'UTR	876 bp
Genome contig ID	gi65519420r_21561252
PolyA signal sequence (None)	+----*----+----*----+----*----+---- AGACTACTTCTAGAAATACTTTCAGACCTACAAAC
Flanking genome sequence (99997 - 99948)	----+----*----+----*----+----*----+----*----+----* AAAAAAGAAAAAAGGCCATTCCGGAGTGACTCCCAGCATCACAGCCCAGA

KIAA	Alignment based on:
KIAA1518	DNA sequence, AA sequence

Coding region: 2..1765

Length: 587 aa

Entry Exp ID% Protein Source BAC32392 1.4e-194 100.0 unnamed protein... Mus musculus Q8BX02 1.4e-194 100.0 KN motif and an... Mus musculus EDL78271 1.4e-170 89.7 rCG31687, isofo... Rattus norvegicus XP_001077488 6.9e-166 88.8 similar to anky... Rattus norvegicus EAW84175 1e-150 80.5 ankyrin repeat ... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122214 2.2e-31 42.0 mKIAA0172

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002110	402	432	PF00023	Ankyrin
	IPR002110	474	506	PF00023	Ankyrin
	IPR002110	507	540	PF00023	Ankyrin
	IPR002110	541	570	PF00023	Ankyrin
HMMSmart	IPR002110	402	432	SM00248	Ankyrin
	IPR002110	436	469	SM00248	Ankyrin
	IPR002110	474	503	SM00248	Ankyrin
	IPR002110	507	537	SM00248	Ankyrin
	IPR002110	541	569	SM00248	Ankyrin
ProfileScan	IPR002110	396	564	PS50297	Ankyrin
	IPR002110	402	427	PS50088	Ankyrin
	IPR002110	474	506	PS50088	Ankyrin

Method	From	To	amino acid sequence
-	-	-	-