ROUGE

Gene/Protein Characteristic Table for mKIAA1494

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173185
Description :	SH3 multiple domains 2 isoform 2. plenty of SH3 domains.
Clone Name :	mpm09319 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 5038 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1726 bp

Genome contig ID gi65515060f_60171482
PolyA signal sequence
(TATAAA,-19)
+----*----+----*----+----*----+----
TTTTTTTTTATATATATATAAAAACACTGTATATT
Flanking genome sequence
(289264 - 289313)
----+----*----+----*----+----*----+----*----+----*
ATGTTCCTTTGTGTTGAATTTTTTTTTTAAAGAAATACTTTACTTGGATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1494 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1494	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 568..3312
Length: 914 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q69ZI1	100.0	Putative E3 ubi...	Mus musculus
AAC40070	99.9	Plenty of SH3s;...	Mus musculus
NP_067481	99.8	SH3 multiple do...	Mus musculus
Q71F54	95.7	Putative E3 ubi...	Rattus norvegicus
XP_001082524	90.4	similar to SH3 ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK029202	1.3e-15	44.0	mFLJ00204

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 161 211 PD000066 SH3

IPR001452 223 277 PD000066 SH3

IPR001452 478 531 PD000066 SH3

IPR001452 866 912 PD000066 SH3

FPrintScan IPR001452 221 231 PR00452 SH3

IPR001452 491 506 PR00452 SH3

IPR001452 521 533 PR00452 SH3

HMMPfam IPR001841 34 74 PF00097 Zinc finger

IPR001452 159 213 PF00018 SH3

IPR011511 160 213 PF07653 Variant SH3

IPR001452 221 279 PF00018 SH3

IPR011511 222 278 PF07653 Variant SH3

IPR001452 477 533 PF00018 SH3

IPR011511 478 533 PF07653 Variant SH3

IPR001452 858 914 PF00018 SH3

IPR011511 859 914 PF07653 Variant SH3

HMMSmart IPR001841 34 74 SM00184 Zinc finger

IPR001452 159 214 SM00326 SH3

IPR001452 221 280 SM00326 SH3

IPR001452 477 534 SM00326 SH3

IPR001452 858 914 SM00326 SH3

ProfileScan IPR001841 34 75 PS50089 Zinc finger

IPR001452 156 215 PS50002 SH3

IPR001452 218 281 PS50002 SH3

NULL 428 453 PS50310 NULL

IPR001452 474 535 PS50002 SH3

IPR001452 861 914 PS50002 SH3

ScanRegExp IPR001841 50 59 PS00518 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	161	211	PD000066	SH3
IPR001452	223	277	PD000066	SH3
IPR001452	478	531	PD000066	SH3
IPR001452	866	912	PD000066	SH3
FPrintScan	IPR001452	221	231	PR00452	SH3
IPR001452	491	506	PR00452	SH3
IPR001452	521	533	PR00452	SH3
HMMPfam	IPR001841	34	74	PF00097	Zinc finger
IPR001452	159	213	PF00018	SH3
IPR011511	160	213	PF07653	Variant SH3
IPR001452	221	279	PF00018	SH3
IPR011511	222	278	PF07653	Variant SH3
IPR001452	477	533	PF00018	SH3
IPR011511	478	533	PF07653	Variant SH3
IPR001452	858	914	PF00018	SH3
IPR011511	859	914	PF07653	Variant SH3
HMMSmart	IPR001841	34	74	SM00184	Zinc finger
IPR001452	159	214	SM00326	SH3
IPR001452	221	280	SM00326	SH3
IPR001452	477	534	SM00326	SH3
IPR001452	858	914	SM00326	SH3
ProfileScan	IPR001841	34	75	PS50089	Zinc finger
IPR001452	156	215	PS50002	SH3
IPR001452	218	281	PS50002	SH3
NULL	428	453	PS50310	NULL
IPR001452	474	535	PS50002	SH3
IPR001452	861	914	PS50002	SH3
ScanRegExp	IPR001841	50	59	PS00518	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1726 bp
Genome contig ID	gi65515060f_60171482
PolyA signal sequence (TATAAA,-19)	+--------+--------+----*----+---- TTTTTTTTTATATATATATAAAAACACTGTATATT
Flanking genome sequence (289264 - 289313)	----+--------+--------+--------+--------+----* ATGTTCCTTTGTGTTGAATTTTTTTTTTAAAGAAATACTTTACTTGGATA

Gene/Protein Characteristic Table for mKIAA1494

Features of the cloned DNA sequence

Features of the protein sequence