KIAA1494

Product ID	ORK06819
Accession No	AB040927
Description	SH3 domain containing ring finger 1
Clone name	fj08673
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4182 bp) Predicted protein sequence (638 aa)
Source	Human fetal brain
Rouge ID	mKIAA1494 by Kazusa Mouse cDNA Project

Length: 4182 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2265 bp
Genome contig ID	gi89161207r_170151982
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- GTTTCAAGATTAAAATTTGATGTTCAAACCTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTCCCTTGTGTCAGTCCTTAAAATTTTGCTTTTTAAAAAAACAAAACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	170251982	170294358	8	99.3	Terminal No-hit

Length: 638 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q7Z6J0	4.7e-193	100.0	Putative E3 ubi...	Homo sapiens
AAH53671	5.4e-193	100.0	SH3RF1 protein ...	Homo sapiens
XP_001152752	2e-192	99.5	SH3 domain cont...	Pan troglodytes
Q5RBR0	3.6e-190	98.7	Putative E3 ubi...	Pongo abelii
XP_001082524	2.4e-189	98.1	similar to SH3 ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	199	252	PD000066	Src homology-3
BlastProDom	IPR001452	590	636	PD000066	Src homology-3
FPrintScan	IPR001452	198	208	PR00452	Src homology-3
	IPR001452	596	611	PR00452	Src homology-3
	IPR001452	613	622	PR00452	Src homology-3
	IPR001452	626	638	PR00452	Src homology-3
HMMPfam	IPR001452	198	254	PF00018	Src homology-3
HMMPfam	IPR001452	590	638	PF00018	Src homology-3
HMMSmart	IPR001452	198	255	SM00326	Src homology-3
HMMSmart	IPR001452	582	638	SM00326	Src homology-3
ProfileScan	IPR001452	195	256	PS50002	Src homology-3
ProfileScan	IPR001452	585	638	PS50002	Src homology-3

Primer_f	GCTTGGTGGGAGTGAATTTGC
Primer_r	CTTATTCATTACCAGGCTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-