| ROUGE |
Gene/Protein Characteristic Table for mKIAA1476 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173180 |
|---|---|
| BROMODOMAIN ADJACENT to zinc finger domain 2B (Fragment). | |
| mfj36368 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4334 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 0 bp Genome contig ID gi66880554r_59672754 PolyA signal sequence
(AAGAAA,-10)
GGCATGGAAAGTGGTGAAGGCCTAGAAGAAATTGCFlanking genome sequence
(96827 - 96778)
AAAAGAAAAAGAAAAGCTTAAAAAGGCAGAGAGTCTCCAGATCAAAGAAG
KIAA Alignment based on: KIAA1476 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 226..4332
Length: 1369 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001739 | 755 | 833 | PF01429 | Methyl-CpG binding |
| IPR004022 | 1047 | 1109 | PF02791 | DDT | |
| HMMSmart | IPR001739 | 758 | 828 | SM00391 | Methyl-CpG binding |
| ProfileScan | NULL | 11 | 67 | PS50324 | NULL |
| NULL | 259 | 283 | PS50324 | NULL | |
| NULL | 614 | 679 | PS50312 | NULL | |
| NULL | 624 | 683 | PS50313 | NULL | |
| IPR004022 | 1047 | 1112 | PS50827 | DDT | |
| NULL | 1256 | 1299 | PS50312 | NULL |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
