ROUGE

Gene/Protein Characteristic Table for mKIAA1475

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173179
Description :	Vacuolar protein sorting 18.
Clone Name :	msh04351 [Vector Info]
Source :	Mouse adult spleen

Features of the cloned DNA sequence	Description

Length: 3117 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 751 bp

Genome contig ID gi66880554f_118707000
PolyA signal sequence
(AATAAA,-9)
+----*----+----*----+----*----+----
AAAAAAAAATTAAATTAAATTAAAAAAATAAAAAT
Flanking genome sequence
(105193 - 105242)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAAGAAGTCCAGAGTCCTGCAAGCCTTTGAGCCTTGGCGTAGGTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1475 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1475	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2366
Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8R307	100.0	Vacuolar protei...	Mus musculus
BAC26302	99.9	unnamed protein...	Mus musculus
BAC28236	99.9	unnamed protein...	Mus musculus
EDL79900	98.5	vacuolar protei...	Rattus norvegicus
BAE28329	98.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007810 105 250 PF05131 Pep3/Vps18/deep orange

ProfileScan IPR000547 428 586 PS50236 7-Fold repeat in clathrin and VPS proteins

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007810	105	250	PF05131	Pep3/Vps18/deep orange
ProfileScan	IPR000547	428	586	PS50236	7-Fold repeat in clathrin and VPS proteins

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	751 bp
Genome contig ID	gi66880554f_118707000
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- AAAAAAAAATTAAATTAAATTAAAAAAATAAAAAT
Flanking genome sequence (105193 - 105242)	----+--------+--------+--------+--------+----* AAAAAGAAGAAGTCCAGAGTCCTGCAAGCCTTTGAGCCTTGGCGTAGGTC

Gene/Protein Characteristic Table for mKIAA1475

Features of the cloned DNA sequence

Features of the protein sequence