ROUGE

Gene/Protein Characteristic Table for mKIAA1462

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220394
Description :
Clone Name :	mbp06230 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 2321 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 42 bp

Genome contig ID gi65551972f_4578669
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGGTGGAGCCCCCACCACCTGCTAGTGGAAAGCTC
Flanking genome sequence
(106380 - 106429)
----+----*----+----*----+----*----+----*----+----*
TCTGGTTGGCCCACCTGTCTTGCTCAGGCAGAAGCTGGAAACTGTGGGGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1462 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA1462	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 3..2279
Length: 758 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_574050	0	81.3	hypothetical pr...	Rattus norvegicus
EDL87451	0	81.3	rCG45278, isofo...	Rattus norvegicus
XP_418578	2.1e-71	41.9	hypothetical pr...	Gallus gallus
CAI46027	6.5e-55	52.6	hypothetical pr...	Homo sapiens
EAW86017	7.4e-55	52.6	hCG1643737, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	42 bp
Genome contig ID	gi65551972f_4578669
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGTGGAGCCCCCACCACCTGCTAGTGGAAAGCTC
Flanking genome sequence (106380 - 106429)	----+--------+--------+--------+--------+----* TCTGGTTGGCCCACCTGTCTTGCTCAGGCAGAAGCTGGAAACTGTGGGGT

Gene/Protein Characteristic Table for mKIAA1462

Features of the cloned DNA sequence

Features of the protein sequence