Order Kazusa clone(s) from : ![]() |
Product ID | ORK01170 |
---|---|
Accession No | AB040895 |
Description | KIAA1462 |
Clone name | ef00562 |
Vector information | |
cDNA sequence | DNA sequence (7539 bp) Predicted protein sequence (1363 aa) |
HaloTag ORF Clone |
FHC01170
![]() |
Flexi ORF Clone | FXC01170 |
Source | |
Rouge ID |
mKIAA1462
by Kazusa Mouse cDNA Project
|
Note | We replaced fh18445, former representative clones for KIAA1462 with ef00562. (2001/2/22) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3429 bp |
---|---|
Genome contig ID | gi89161187r_30243390 |
PolyA signal sequence (ATTAAA,-33) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 30343390 | 30376777 | 3 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | GCCTGTTCTCATCTGTACCGT |
---|---|
Primer_r | CTGCTGTGAAAACTGGAGTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |