ROUGE

Gene/Protein Characteristic Table for mKIAA1390

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC039762
Description :	RIKEN cDNA 4930504E06. cDNA sequence, clone 2-4. NF-E2 inducible protein.
Clone Name :	mpj01642 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1571 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 434 bp

Genome contig ID gi65492966f_94676050
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCCTAGAGGTTTGGAAATAAAACTTCTTTCCTGAC
Flanking genome sequence
(107948 - 107997)
----+----*----+----*----+----*----+----*----+----*
GATTTGCGTTCCTACCTTGGAGCAGGGGAGTAAAATATTTGACCCGGTTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1390 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1390	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1137
Length: 378 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH39762	3.9e-154	100.0	Fam63a protein ...	Mus musculus
AAH51048	4.1e-154	100.0	Fam63a protein ...	Mus musculus
BAE41294	4.4e-154	100.0	unnamed protein...	Mus musculus
Q76LS9	4.4e-154	100.0	Protein FAM63A;...	Mus musculus
AAH94388	9.2e-154	99.7	Fam63a protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220158	1.9e-68	58.4	mKIAA1164

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007518 53 178 PF04424 Protein of unknown function DUF544

ProfileScan NULL 296 342 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007518	53	178	PF04424	Protein of unknown function DUF544
ProfileScan	NULL	296	342	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	434 bp
Genome contig ID	gi65492966f_94676050
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCCTAGAGGTTTGGAAATAAAACTTCTTTCCTGAC
Flanking genome sequence (107948 - 107997)	----+--------+--------+--------+--------+----* GATTTGCGTTCCTACCTTGGAGCAGGGGAGTAAAATATTTGACCCGGTTG

Gene/Protein Characteristic Table for mKIAA1390

Features of the cloned DNA sequence

Features of the protein sequence