ROUGE |
Gene/Protein Characteristic Table for mKIAA1390 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC039762 |
---|---|
RIKEN cDNA 4930504E06. cDNA sequence, clone 2-4. NF-E2 inducible protein. |
|
mpj01642 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1571 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 434 bp Genome contig ID gi65492966f_94676050 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TCCTAGAGGTTTGGAAATAAAACTTCTTTCCTGACFlanking genome sequence
(107948 - 107997) ----+----*----+----*----+----*----+----*----+----*
GATTTGCGTTCCTACCTTGGAGCAGGGGAGTAAAATATTTGACCCGGTTG
KIAA Alignment based on: KIAA1390 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1137
Length: 378 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |