ROUGE

Gene/Protein Characteristic Table for mKIAA1375

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129340
Description :	Programmed cell death 6 interacting protein.
Clone Name :	mpm05366 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4410 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1678 bp

Genome contig ID gi65519420r_113606450
PolyA signal sequence
(AATAGA,-8)
+----*----+----*----+----*----+----
ATTCCTTATGAATGCAAAACAACCACCAATAGAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGAAAAAGAAAAAAATGGCCTGAATATTCTCTTGGGAAAGGGGGTTGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1375 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1375	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2732
Length: 909 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL08948	0	99.3	programmed cell...	Mus musculus
BAE41316	4.9e-213	99.9	unnamed protein...	Mus musculus
Q9WU78	7.1e-213	99.8	Programmed cell...	Mus musculus
AAH26823	9.2e-213	99.8	Programmed cell...	Mus musculus
EDL08949	1.3e-212	99.5	programmed cell...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004328 43 207 PF03097 BRO1

ProfileScan IPR000694 757 901 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004328	43	207	PF03097	BRO1
ProfileScan	IPR000694	757	901	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1678 bp
Genome contig ID	gi65519420r_113606450
PolyA signal sequence (AATAGA,-8)	+--------+--------+----*----+---- ATTCCTTATGAATGCAAAACAACCACCAATAGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAAAAAGAAAAAAATGGCCTGAATATTCTCTTGGGAAAGGGGGTTGG

Gene/Protein Characteristic Table for mKIAA1375

Features of the cloned DNA sequence

Features of the protein sequence