KIAA1375

Product ID	ORK06302
Accession No	AB037796
Description	programmed cell death 6 interacting protein
Clone name	fj04426
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4823 bp) Predicted protein sequence (546 aa)
Source	Human fetal brain
Rouge ID	mKIAA1375 by Kazusa Mouse cDNA Project

Length: 4823 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3182 bp
Genome contig ID	gi89161205f_33752672
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAATGTATGCTAGAAATAAAAGTTGAAAGATTCTT
Flanking genome sequence (133528 - 133577)	----+--------+--------+--------+--------+----* ACTTCTTTGGAGTATGAATTCTTATTTAAAGTGTTTATTCTTCAGCTTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	33852672	33886198	11	99.2	Perfect prediction

Length: 546 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAK20398	1.7e-128	100.0	HP95 [Homo sapi...	Homo sapiens
XP_001169526	2.5e-128	99.8	programmed cell...	Pan troglodytes
Q8WUM4	2.5e-128	99.8	Programmed cell...	Homo sapiens
AAH68454	2.7e-128	99.6	PDCD6IP protein...	Homo sapiens
BAH12857	3.4e-128	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	395	411	PR01217	NULL
	NULL	415	427	PR01217	NULL
	NULL	427	448	PR01217	NULL
	NULL	458	474	PR01217	NULL
	NULL	484	501	PR01217	NULL
HMMPfam	IPR004328	1	60	PF03097	BRO1
ProfileScan	IPR004328	1	70	PS51180	BRO1

Primer_f	GTCACGACAAACCAATCAATC
Primer_r	ACTATAAAGACTGCTGACTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-