ROUGE

Gene/Protein Characteristic Table for mKIAA1367

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC013628
Description :	Cleavage and polyadenylation specificity factor, 100 kDa subunit.
Clone Name :	mpm06060 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4815 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2307 bp

Genome contig ID gi65532617f_97321468
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GGTGACCTGAGACAATAAAGAAGAAATTAGTTTGT
Flanking genome sequence
(129520 - 129569)
----+----*----+----*----+----*----+----*----+----*
ACGGTGGGTTGTTTACCTTTTTTTTTCCTTTCCTTTTTTTTTTTTTTCTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1367 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1367	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 79..2508
Length: 809 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O35218	100.0	Cleavage and po...	Mus musculus
EDL81741	99.1	cleavage and po...	Rattus norvegicus
XP_001092942	98.1	similar to clea...	Macaca mulatta
XP_001497134	98.1	similar to Clea...	Equus caballus
Q10568	98.2	Cleavage and po...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011108 554 596 PF07521 RNA-metabolising metallo-beta-lactamase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011108	554	596	PF07521	RNA-metabolising metallo-beta-lactamase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2307 bp
Genome contig ID	gi65532617f_97321468
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GGTGACCTGAGACAATAAAGAAGAAATTAGTTTGT
Flanking genome sequence (129520 - 129569)	----+--------+--------+--------+--------+----* ACGGTGGGTTGTTTACCTTTTTTTTTCCTTTCCTTTTTTTTTTTTTTCTT

Gene/Protein Characteristic Table for mKIAA1367

Features of the cloned DNA sequence

Features of the protein sequence