ROUGE |
Gene/Protein Characteristic Table for mKIAA1341 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129336 |
---|---|
mpj01106 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2831 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1310 bp Genome contig ID gi66880554r_124501596 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
ATTGTCTTTATTTATTAAACCATTTTTAATAAGGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATACAGCTTACTTGTTGCTTTTTATTCTCATTTGACAGTGAATTACCATC
KIAA Alignment based on: KIAA1341 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1521
Length: 506 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000504 | 111 | 182 | PF00076 | RNA-binding region RNP-1 (RNA recognition motif) |
IPR000504 | 244 | 314 | PF00076 | RNA-binding region RNP-1 (RNA recognition motif) | |
HMMSmart | IPR000504 | 110 | 183 | SM00360 | RNA-binding region RNP-1 (RNA recognition motif) |
IPR000504 | 243 | 315 | SM00360 | RNA-binding region RNP-1 (RNA recognition motif) | |
ProfileScan | IPR000504 | 109 | 187 | PS50102 | RNA-binding region RNP-1 (RNA recognition motif) |
IPR000504 | 242 | 319 | PS50102 | RNA-binding region RNP-1 (RNA recognition motif) | |
NULL | 339 | 498 | PS50315 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |