Gene/Protein Characteristic Table for mKIAA1341

Length: 2831 bp

Restriction map

Length of 3'UTR	1310 bp
Genome contig ID	gi66880554r_124501596
PolyA signal sequence (ATTAAA,-22)	+----*----+----*----+----*----+---- ATTGTCTTTATTTATTAAACCATTTTTAATAAGGT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATACAGCTTACTTGTTGCTTTTTATTCTCATTTGACAGTGAATTACCATC

KIAA	Alignment based on:
KIAA1341	DNA sequence, AA sequence, Physical map

Coding region: 1..1521

Length: 506 aa

Entry Exp ID% Protein Source CAM20169 2.9e-170 100.0 myelin basic pr... Mus musculus BAB14421 1.9e-152 89.5 unnamed protein... Homo sapiens EAW77338 3.5e-152 89.3 myelin expressi... Homo sapiens Q8C854 1.1e-150 95.3 Myelin expressi... Mus musculus NP_001013223 2.8e-149 94.3 myelin expressi... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220299 6.8e-36 48.9 mKIAA4193

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	111	182	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000504	244	314	PF00076	RNA-binding region RNP-1 (RNA recognition motif)
HMMSmart	IPR000504	110	183	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000504	243	315	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	IPR000504	109	187	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
	IPR000504	242	319	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
	NULL	339	498	PS50315	NULL

Method	From	To	amino acid sequence
-	-	-	-