ROUGE |
Gene/Protein Characteristic Table for mKIAA1338 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129334 |
---|---|
GCN2 eIF2alpha kinase. | |
mpm06205 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4560 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 171 bp Genome contig ID gi66880554f_117831074 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
AATTTACCTTTTTGATATAATAAATGTTTTCATAGFlanking genome sequence
(158009 - 158058) ----+----*----+----*----+----*----+----*----+----*
ATATCTGCTGTTTTCCATTTGCAGTTCTGCCAATACTAGCCCTTATGTGG
KIAA Alignment based on: KIAA1338 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..868, 1063..4389
Length: 1397 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 102 | 201 | PD000001 | Protein kinase |
IPR000719 | 338 | 407 | PD000001 | Protein kinase | |
IPR000719 | 543 | 740 | PD000001 | Protein kinase | |
HMMPfam | IPR000719 | 338 | 749 | PF00069 | Protein kinase |
IPR002314 | 807 | 971 | PF00587 | tRNA synthetase | |
HMMSmart | IPR002290 | 338 | 749 | SM00220 | Serine/threonine protein kinase |
IPR001245 | 338 | 749 | SM00219 | Tyrosine protein kinase | |
ProfileScan | IPR000719 | 39 | 335 | PS50011 | Protein kinase |
IPR000719 | 338 | 749 | PS50011 | Protein kinase | |
ScanRegExp | IPR000719 | 344 | 367 | PS00107 | Protein kinase |
IPR008271 | 591 | 603 | PS00108 | Serine/threonine protein kinase |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |