Gene/Protein Characteristic Table for mKIAA1338

Length: 4560 bp

Restriction map

Length of 3'UTR	171 bp
Genome contig ID	gi66880554f_117831074
PolyA signal sequence (AATAAA,-17)	+----*----+----*----+----*----+---- AATTTACCTTTTTGATATAATAAATGTTTTCATAG
Flanking genome sequence (158009 - 158058)	----+----*----+----*----+----*----+----*----+----* ATATCTGCTGTTTTCCATTTGCAGTTCTGCCAATACTAGCCCTTATGTGG

KIAA	Alignment based on:
KIAA1338	DNA sequence, AA sequence, Physical map

Coding region: 2..868, 1063..4389

Length: 1397 aa

Entry Exp ID% Protein Source EDL27907 0 98.4 eukaryotic tran... Mus musculus CAB58363 0 98.2 GCN2 eIF2alpha ... Mus musculus CAM24688 0 98.1 eukaryotic tran... Mus musculus CAM24687 0 98.1 eukaryotic tran... Mus musculus CAM24686 0 98.1 eukaryotic tran... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173160 4e-09 32.6 mKIAA1369

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	102	201	PD000001	Protein kinase
	IPR000719	338	407	PD000001	Protein kinase
	IPR000719	543	740	PD000001	Protein kinase
HMMPfam	IPR000719	338	749	PF00069	Protein kinase
	IPR002314	807	971	PF00587	tRNA synthetase
HMMSmart	IPR002290	338	749	SM00220	Serine/threonine protein kinase
	IPR001245	338	749	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	39	335	PS50011	Protein kinase
	IPR000719	338	749	PS50011	Protein kinase
ScanRegExp	IPR000719	344	367	PS00107	Protein kinase
	IPR008271	591	603	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-