Gene/Protein Characteristic Table for mKIAA1336

Length: 3941 bp

Restriction map

Length of 3'UTR	1096 bp
Genome contig ID	gi65532617f_8190375
PolyA signal sequence (AATAAA,-23)	+----*----+----*----+----*----+---- ACTTGCAAATAAAATAAACATCACATACCAAAATT
Flanking genome sequence (148936 - 148985)	----+----*----+----*----+----*----+----*----+----* AAGTAGCCCCAAAGTCTATACATTTTAATGAACTTCTATCCAGTTAGAAT

KIAA	Alignment based on:
KIAA1336	DNA sequence, AA sequence, Physical map

Coding region: 56..2845

Length: 929 aa

Entry Exp ID% Protein Source EDK98417 0 100.0 WD repeat domai... Mus musculus Q8BND3 0 99.9 WD repeat-conta... Mus musculus XP_001072062 0 98.7 similar to WD r... Rattus norvegicus XP_532884 0 94.5 similar to WD r... Canis lupus fam... XP_001107482 0 92.7 WD repeat domai... Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173165 7.9e-19 27.7 mKIAA1397

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	19	56	PF00400	WD-40 repeat
	IPR001680	76	113	PF00400	WD-40 repeat
	IPR001680	120	157	PF00400	WD-40 repeat
HMMSmart	IPR001680	19	56	SM00320	WD-40 repeat
	IPR001680	74	113	SM00320	WD-40 repeat
	IPR001680	118	157	SM00320	WD-40 repeat
	IPR001680	161	198	SM00320	WD-40 repeat
ProfileScan	IPR001680	81	112	PS50082	WD-40 repeat
	IPR001680	81	166	PS50294	WD-40 repeat

Method	From	To	amino acid sequence
-	-	-	-