ROUGE |
Gene/Protein Characteristic Table for mKIAA1327 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122495 |
---|---|
mbg04856 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5540 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1291 bp Genome contig ID gi65498774r_40443494 PolyA signal sequence
(TATAAA,-16) +----*----+----*----+----*----+----
TGAAATTTTATATATAAATTATAAAATGTTTCCCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAACTTGAGTGACAAGAATTTTTTTCCCCATGTCTTAAAAGCCAATGCG
KIAA Alignment based on: KIAA1327 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..4249
Length: 1415 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000637 | 1237 | 1247 | PR00929 | HMG-I and HMG-Y |
IPR000637 | 1306 | 1316 | PR00929 | HMG-I and HMG-Y | |
HMMPfam | IPR000637 | 1237 | 1249 | PF02178 | HMG-I and HMG-Y |
ProfileScan | NULL | 1069 | 1361 | PS50313 | NULL |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |