KIAA1327

Product ID	ORK04970
Accession No	AB037748
Description	biorientation of chromosomes in cell division 1-like 1
Clone name	fh14466s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6687 bp) Predicted protein sequence (1804 aa)
Source	Human fetal brain
Rouge ID	mKIAA1327 by Kazusa Mouse cDNA Project
Note	We replaced fh14466, former representative clones for KIAA1327 with fh14466s1. (2002/5/10)

Length: 6687 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1270 bp
Genome contig ID	gi89161207r_13079464
PolyA signal sequence (TATAAA,-15)	+--------+--------+----*----+---- CTGAGATTTTATATATAAATTATAAAATGTTTACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATTTGAGTGGTAAGAATTTTATTTGTGTGTTTTAAAATGTGTCTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	13179464	13213882	17	99.2	Perfect prediction

Length: 1804 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8NFC6	0	99.9	Protein FAM44A.	Homo sapiens
XP_001098928	0	94.8	similar to CG55...	Macaca mulatta
XP_001917633	0	76.5	similar to Prot...	Equus caballus
XP_585315	0	63.0	hypothetical LO...	Bos taurus
BAG60410	6.6e-197	99.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000637	1625	1637	PF02178	HMG-I and HMG-Y

Primer_f	TACTTGCATCTGTGACTTTAC
Primer_r	GGAAAGAGTATTGGTAGAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-