ROUGE |
Gene/Protein Characteristic Table for mKIAA1323 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129331 |
---|---|
ubiquitin ligase mind bomb. mind bomb homolog (Drosophila). DAPK-interacting protein-1. |
|
mpm05352 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1349 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 917 bp Genome contig ID gi65551972f_10747609 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GCTTTTTAGAACAACAATAAATGTTCAAAAAATGCFlanking genome sequence
(116442 - 116491) ----+----*----+----*----+----*----+----*----+----*
AGTGAAGTGTGAGAGGCGTGGGAAGCCCACAGTTGCTGTAATCTGAGCCT
KIAA Alignment based on: KIAA1323 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..432
Length: 143 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |