ROUGE

Gene/Protein Characteristic Table for mKIAA1323

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129331
Description :	ubiquitin ligase mind bomb. mind bomb homolog (Drosophila). DAPK-interacting protein-1.
Clone Name :	mpm05352 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 1349 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 917 bp

Genome contig ID gi65551972f_10747609
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GCTTTTTAGAACAACAATAAATGTTCAAAAAATGC
Flanking genome sequence
(116442 - 116491)
----+----*----+----*----+----*----+----*----+----*
AGTGAAGTGTGAGAGGCGTGGGAAGCCCACAGTTGCTGTAATCTGAGCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1323 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1323	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..432
Length: 143 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE36604	5.2e-57	100.0	unnamed protein...	Mus musculus
AAH11287	6.9e-57	100.0	Mib1 protein [M...	Mus musculus
AAH83072	7.7e-57	100.0	Mib1 protein [M...	Mus musculus
BAC35245	9.8e-57	100.0	unnamed protein...	Mus musculus
AAI31663	1.3e-56	100.0	Mib1 protein [M...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001841 3 37 SM00184 Zinc finger

IPR001841 100 132 SM00184 Zinc finger

ProfileScan IPR001841 3 38 PS50089 Zinc finger

IPR001841 100 133 PS50089 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001841	3	37	SM00184	Zinc finger
IPR001841	100	132	SM00184	Zinc finger
ProfileScan	IPR001841	3	38	PS50089	Zinc finger
IPR001841	100	133	PS50089	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	917 bp
Genome contig ID	gi65551972f_10747609
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GCTTTTTAGAACAACAATAAATGTTCAAAAAATGC
Flanking genome sequence (116442 - 116491)	----+--------+--------+--------+--------+----* AGTGAAGTGTGAGAGGCGTGGGAAGCCCACAGTTGCTGTAATCTGAGCCT

Gene/Protein Characteristic Table for mKIAA1323

Features of the cloned DNA sequence

Features of the protein sequence