ROUGE |
Gene/Protein Characteristic Table for mKIAA1299 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173145 |
---|---|
SH2-B PH domain containing signaling mediator 1. | |
mek01601 [Vector Info] | |
Source : | Mouse embryonic intestinal tract |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1043 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 122 bp Genome contig ID gi65511124r_120416726 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
TAAATAAATAAAGGGTTTATCTCAGTTCCATCATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATGGCTGTGGCTGATATTTGGAGTAGGACCTGGGATGGGCGGATAAAGCT
KIAA Alignment based on: KIAA1299 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..921
Length: 306 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |