ROUGE

Gene/Protein Characteristic Table for mKIAA1293

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC048497
Description :	farnesyl diphosphate synthetase.
Clone Name :	mbk00773 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 1187 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 54 bp

Genome contig ID gi65492966r_88737454
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GGGAGGGAGGGGGTCTCAATAAATTATTGTTCAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCCTGTGGTTTTATTCTTGTGGCAGTCAGGAGTTCAGCTTTATCCAGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1293 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1293	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1133
Length: 376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL15238	1.8e-156	100.0	mCG17543, isofo...	Mus musculus
Q920E5	2.9e-153	100.0	Farnesyl pyroph...	Mus musculus
BAE38529	7.5e-153	99.7	unnamed protein...	Mus musculus
BAE24508	1.2e-152	99.7	unnamed protein...	Mus musculus
AAH87886	2.7e-152	99.7	Farnesyl diphos...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000092 67 339 PF00348 Polyprenyl synthetase

ScanRegExp IPR000092 123 137 PS00723 Polyprenyl synthetase

IPR000092 258 270 PS00444 Polyprenyl synthetase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000092	67	339	PF00348	Polyprenyl synthetase
ScanRegExp	IPR000092	123	137	PS00723	Polyprenyl synthetase
IPR000092	258	270	PS00444	Polyprenyl synthetase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	54 bp
Genome contig ID	gi65492966r_88737454
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGGAGGGAGGGGGTCTCAATAAATTATTGTTCAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCCTGTGGTTTTATTCTTGTGGCAGTCAGGAGTTCAGCTTTATCCAGAA

Gene/Protein Characteristic Table for mKIAA1293

Features of the cloned DNA sequence

Features of the protein sequence